![]() |
CHE530/730 |
Use the following outline in preparing for the first exam. Homework problems are at the end of this document.
I. Water
Describe the types of intermolecular interactions
Be able to explain how the polarity of water leads to the hydrophobic effect
Calculate pH and buffer concentrations given the Henderson-Hasselbalch equation
II. Protein structure
Be able to draw the structures of the amino acids
Know approximately the pKs of ionizable side chains
Be able to explain how the resonance in the peptide bond leads to its characteristic planar structure
Describe the levels of protein structure
Characterize how intermolecular forces maintain protein structure
Explain the action of a number of protein denaturants
Tell how the use of denaturants can be used to show the connection between protein struncture and function (via the Anfinson experiment)
Describe the Levinthal Paradox and proposed solutions to it
Explain how chaperonins are able to assist in protein folding.
III. Protein analysis
Be able to describe the methodology and purpose for each of the following techniques:
SDS-PAGE gels
Isoelectric focusing gels
2-D gels
Size-exclusion chromatography
Ion exchange chromatography
Affinity chromatography
Protein sequencing
X-ray crystallographic analysis
UV absorbance of protein samples
Circular Dichroism and Optical Rotatory Dispersion
Calculation of protein activity and specific activity
IV. Nucleic acid structure
Describe the structure of DNA and RNA
Know some of the history behind DNA science:Explain the fundamental difficulty in determining the function of DNA
Describe some key experiments in elucidating the genetic function of DNA
Describe the roles of Crick, Watson, and Franklin in working out DNA's structure
Be able to explain how semi-conservative replication was demonstratedBe able to explain the denaturation of DNA and its measurement
Describe the central dogma of molecular biology
Explain the genetic code and be able to use it to predict protein sequence
V. Nucleic acid analysis
Know some of the enzymes involved in DNA and RNA analysis:
DNA polymerase (including the Taq enzyme and Klenow fragment)
Restriction enzymes
Exo- and endonucleases
DNA ligase
RibonucleaseBe able to describe how to carry out the following procedures and their scientific utility:
DNA sequencing
RFLP analysis
Restriction mapping
PCR
Recombinant DNA work
Southern blotting (and its Northern and Western analogues)
Hybridization
The different types of gels used in DNA analysis
Ultracentrifugation as an analytical toolHomework
Do any 10 of the following text homework problems
Read these chapters |
Chapter problems |
||
5th ed |
6th ed |
5th ed |
6th ed |
1 |
1 |
1, 3, 10 |
|
3 |
2 |
2, 3, 6 |
2, 3, 6 |
4 |
3 |
1, 4, 7 , 11, 13 |
1, 4, 7, 11, 12, 13 |
5 |
4 |
1, 2, 4, 7, 8, 9, 12, 13, 14, 15, 20, 23, 24 |
1, 2, 4, 7, 8, 9, 12, 13, 14, 15, 20, 22, 23 |
6 |
5 |
1, 2, 3, 4, 7, 8, 12, 14 |
1, 2, 3, 4, 7, 8, 12, 13, 15 |
Supplemental problems (Choose any 20 of these):
1. A sample of blood was assessed to contain 10.0 mM carbonic acid and 85.1 mM bicarbonate ion. What was its pH if the bicarbonate pKa is 6.37?
2. Under physiological conditions (pH about 7.3), is blood (principally buffered by bicarbonate) better buffered against an infusion of acid or an infusion of base? Why is it more important one and not the other?
3. How many grams of NaOH and how many grams of acetic acid are required to form 100 mL of a 0.1 M Na acetate solution at pH 5.2 if the pKa of the acetate system is 4.8?
4. Explain the insolubility of non-polar molecules in water.
| 5. Molecules that are hydrophobic can often penetrate membranes in the stomach and intestine and pass into the bloodstream. Conversely, molecules that are charged or hydrophilic are generally not rapidly absorbed through membranes. Thus, one can predict whether pharmaceutical compounds taken orally will be quickly absorbed in the stomach (pH1-2) or whether they must pass into the intestine (more basic pH) before being absorbed. Ambucetamide is used as an antispasmodic drug. Its tertiary amino group has pKa=8.4. Calculate the percentage of this drug which can be absorbed in the upper intestine (pH 5.0) and compare with the percentage absorbable in the lower intestine (pH 8.0). The structure of this drug is as shown at left. |
![]() |
6. Show the structures of the following amino acids at the indicated pH: alanine, pH 7.0; aspartic acid, pH 5.0; histidine, pH 5.0; histidine, pH 7.0; lysine, pH 12.0; glutamine, pH 12.0.
7. Is the dipeptide ala-phe the same as the dipeptide phe-ala? Explain using a diagram.
8. Which amino acid side chains are primarily negatively charged under conditions of physiological pH?
9. Which amino acid side chains are primarily positively charged under conditions of physiological pH?
10. What other source of charge is there at physiological pH on a polypeptide?
11. What is the net charge on the following peptide at pH = 7.0?
phe-lys-his-leu-lys-thr-glu-ala-glu-met-lys-ala-ser-glu-asp
12. At which pH is a solution of histidine most well-buffered?
13. In peptides, there is a significant difference between the lengths of the nitrogen-a carbon bond (N-Ca) and the carbonyl carbon-nitrogen bond (N-Co). Explain the difference in lengths. The lengths of these and related bonds are as follows:
N-Ca 14.7 nm
N-Co 13.2 nm
N=C 12.5 nm
14. The a-helix has a pronounced dipole. Draw a segment of an a-helix and explain the origin of the dipole. Indicate the direction of the dipole with an arrow whose head represents the negative end of the dipole.
15. Why would proline be a "helix breaker" in proteins?
16. Polyaspartate (asp)n, forms substantial amounts of a-helices in aqueous solution at pH 2, but at pH 5 or higher it assumes a random coil configuration. Explain. At what pH will (arg)n form a-helical coils (above or below this value?)
17. In a particular enzyme, an alanine residue is located in a cleft where the substrate binds. A mutation that changes this residue to a glycine has no effect on activity. However, another mutation, which changes the alanine to a glutamate residue, leads to a complete loss of activity. Explain these observations.
18. Before Anfinsen carried out his work on refolding in ribonuclease, some scientists argued that directions for folding are given to the protein during its biosynthesis. How did Anfinsen's experiments contradict that argument?
19. Most of the protein purification methods described in this lecture are used to purify enzymes in their native state. Why would the use of SDS-polyacrylamide gel electrophoresis be unlikely to lead to the successful purification of an active enzyme?
20. A laboratory group wishes to prepare a monoclonal antibody that can be used to react with a specific viral-coat protein in a Western-blotting procedure. Why would it be a good idea to treat the viral-coat protein with SDS before attempting to elicit monoclonal antibodies?
21. Most enzymes are relatively stable in the pH range from 5.5 to 8.5. Proteins with few histidine residues exhibit relatively stable affinities for ion exchangers over that pH range., whereas proteins with significant percentages of histidine residues vary greatly in their affinities for ion exchangers over the same pH range. Why?
22. Random protease digestion of a certain peptide hormone (length=20 amino acyl residues) revealed the following peptide fragments:
| TRP-GLY-LYS-PRO | VAL-GLY-LYS-LYS |
| SER-MET-GLU-HIS | PRO-ILE |
| ARG-ARG-PRO-ILE | ARG-TRP-GLY-LYS |
| PHE-ARG-TRP-GLY | LYS-ARG-ARG-PRO |
| LYS-LYS-ARG-ARG | PRO-VAL-GLY-LYS |
| LYS-PRO-VAL-GLY | MET-TYR-SER |
|
MET-TYR
|
MET-TYR-SER-MET |
| MET-GLU-HIS-PHE | TRP-GLY-LYS-PRO |
among others.
What is the likely sequence of the hormone?
23. Consider two solutions containing different purified DNAs. One is from the bacterium P. aeruqinosa and has a GC composition of 68% whereas the other is from a mammal and has a GC composition of 42.5%. Hyperchromicity of each solution is measured as a function of increasing temperature. Which solution has the higher Tm value, and why? After they melt, the solutions are mixed together and allowed to cool. What would then happen to the DNA? Would appreciable amounts of bacterial DNA then be found associated in a helix with mammalian DNA? Explain.
24. Describe an experiment which would confirm Watson and Crick's prediction of a semi-conservative model for DNA replication.
25. You have a double-stranded linear DNA molecule, the appropriate primers, all the enzymes required for DNA replication, four 32P-labeled nucleoside triphosphates, Mg2+ ion, and the equipment needed to detect newly synthesized radioactive DNA. Why is this system not sufficient to distinguish between conservative and semiconservative replication of the DNA molecule?
26. Spiegelman found that some types of single-stranded RNA can associate with single-stranded DNA to form double-stranded molecules (termed heteroduplexes). What is the most important condition that must be satisfied in order to allow the formation of these hybrid molecules?
27. The value of Tm for DNA (in c) can be calculated using the formula Tm = 69.3 + 0.41(GC) where GC is the mole percentage of guanine plus cytosine. A sample of DNA from E. Coli contains 50 mole percent GC. At what temperature would you expect this DNA molecule to melt? The melting curves for most naturally occuring DNA molecules reveal that the Tm is normally greater than 65 c. Why is this important for most organisms? What kinds of organisms would you expect to have a significantly higher Tm for its DNA?
28. If you have samples of pure RNA and duplex DNA, how can you tell whether they have any complementary nucleotide sequences?
29. If all of the RNA in question 28 were to contain sequences that are complementary to the DNA, will its percentage of G and C be identical to that of the DNA? Explain.
30. Certain DNA endonucleases degrade double stranded DNA to yield mononucleotides and dinucleotides, but these enzymes do not degrade those sequences to which other proteins are bound. Describe an experiment in which a DNA polymerase and RNA polymerase can be used to locate a promoter site. Why should this process be performed in the absence of ribonucleotide triphosphates?
31. The amino acid at position 102 in the primary sequence of a bacterial enzyme is valine, and the corresponding codon in the mRNA sequence for the enzyme is GUU. Suppose a mutation that alters the codon to GCU has no effect on the activity of the enzyme, but another mutation that changes the codon to GAU completely inactivates the enzyme. Briefly explain these observations.
32. The following represents a sequenced gene. The start site (promoter) for transcription is located to the left. Show the derived RNA sequence and predict the sequence of the resultant protein. Draw the linear structure of this protein. Finally, schematically show how it would be expected to fold into its final conformation at neutral pH.
CCATGTGAATAAGATGTGCCATTCAATACCGGTATTCGACTGCTGATAGTAGTC GGTACACTTATTCTACACGGTAAGTTATCCGGATATGCTGACGACTATCATCAG
33. How might the fact that some exons encode discrete functional domains in proteins be related to the evolution of new proteins?
34. Careful gel electrophoresis analysis of restriction enzyme digestion of a plasmid showed plasmid fragments with sizes as given in the table. Restriction enzymes were used either singly or in combination as shown. Recall that plasmids are circular, and all fragments listed are linear. What is the relative position on the plasmid of each enzyme site? Show the distance in base pairs between each site.
|
Restriction enzyme
|
Fragment length
|
||||||
|
Eco RI
|
1860
|
1420
|
390
|
||||
|
Bam HI
|
3670
|
||||||
|
Hind III
|
1260
|
1230
|
960
|
220
|
|||
|
EcoRI/Bam HI
|
1860
|
1420
|
270
|
120
|
|||
|
Bam HI/Hind III
|
1260
|
1230
|
960
|
170
|
50
|
||
|
Eco RI/Hind III
|
1190
|
860
|
670
|
560
|
220
|
70
|
100
|
35. What is the ratio of base to acid at pH 4, 5, 6, 7, and 8 for an acid with
a pK of 6?
36. What is the Levinthal Paradox? Describe the fundamental problem associated with protein folding.
37. What is the major force determining the course of protein folding, and how does this help a protein fold into its correct conformation?
38. What are molten globules? Why is their formation so much more rapid than the complex predictions of the Levinthal paradox?
39. Explain the role of chaperones and related proteins, and how they work.
40. What advantage is there in proteins being inherently unstable?
This homework set and study guide was prepared by Dr. Martin Brock at Eastern Kentucky University.